1. The ACE2 gene connectome - List of genes from network sources

Data collection

## Cache found

2. Tissue enrichment

Tissue enrichment of all genes (analyzed in FUMA)

Tissue enrichment of all genes (analyzed in FUMA)

3. Gene-drug interactions and enrichment of functional processes from drugs

A. Gene-drug interaction from dgidb

B. Gene function enrichment (from Reactome db) of aforementioned identified drugs

Table for above graph

Pathway based similarity of drugs

Pathway based similarity of drugs

4. PheWAS of genes

AAMP

## [1] "Number of data points: 245"
## 
## Not.Signi     Signi 
##       203        42

ACE

## [1] "Number of data points: 323"
## 
## Not.Signi     Signi 
##       300        23

ACE2

## [1] "Number of data points: 64"
## 
## Not.Signi 
##        64

ALDOB

## [1] "Number of data points: 240"
## 
## Not.Signi     Signi 
##       239         1

AGT

## [1] "Number of data points: 393"
## 
## Not.Signi     Signi 
##       380        13

APOA1

## [1] "Number of data points: 401"
## 
## Not.Signi     Signi 
##       296       105

APOBEC1

## [1] "Number of data points: 267"
## 
## Not.Signi     Signi 
##       265         2

CALM1

## [1] "Number of data points: 259"
## 
## Not.Signi 
##       259

CALM2

## [1] "Number of data points: 247"
## 
## Not.Signi     Signi 
##       237        10

CAT

## [1] "Number of data points: 228"
## 
## Not.Signi     Signi 
##       226         2

CLCA1

## [1] "Number of data points: 324"
## 
## Not.Signi     Signi 
##       322         2

DEFA5

## [1] "Number of data points: 223"
## 
## Not.Signi     Signi 
##       212        11

DEFA6

## [1] "Number of data points: 218"
## 
## Not.Signi 
##       218

DPEP1

## [1] "Number of data points: 466"
## 
## Not.Signi     Signi 
##       400        66

DPP4

## [1] "Number of data points: 477"
## 
## Not.Signi     Signi 
##       431        46

FABP1

## [1] "Number of data points: 260"
## 
## Not.Signi     Signi 
##       258         2

FABP2

## [1] "Number of data points: 422"
## 
## Not.Signi     Signi 
##       382        40

GHRL

## [1] "Number of data points: 314"
## 
## Not.Signi     Signi 
##       311         3

HRAS

## [1] "Number of data points: 226"
## 
## Not.Signi     Signi 
##       224         2

ISYNA1

## [1] "Number of data points: 425"
## 
## Not.Signi     Signi 
##       393        32

IYD

## [1] "Number of data points: 256"
## 
## Not.Signi 
##       256

KDM3A

## [1] "Number of data points: 342"
## 
## Not.Signi     Signi 
##       292        50

LACTB2

## [1] "Number of data points: 376"
## 
## Not.Signi     Signi 
##       357        19

LRRC19

## [1] "Number of data points: 269"
## 
## Not.Signi     Signi 
##       266         3

MEP1A

## [1] "Number of data points: 243"
## 
## Not.Signi 
##       243

MEP1B

## [1] "Number of data points: 237"
## 
## Not.Signi     Signi 
##       236         1

MME

## [1] "Number of data points: 296"
## 
## Not.Signi     Signi 
##       294         2

NTS

## [1] "Number of data points: 196"
## 
## Not.Signi     Signi 
##       195         1

PDE9A

## [1] "Number of data points: 366"
## 
## Not.Signi     Signi 
##       360         6

PLA2G12B

## [1] "Number of data points: 307"
## 
## Not.Signi     Signi 
##       302         5

POU2F1

## [1] "Number of data points: 314"
## 
## Not.Signi     Signi 
##       307         7

PRCP

## [1] "Number of data points: 313"
## 
## Not.Signi     Signi 
##       308         5

RASEF

## [1] "Number of data points: 257"
## 
## Not.Signi     Signi 
##       254         3

SI

## [1] "Number of data points: 217"
## 
## Not.Signi     Signi 
##       216         1

SLC10A2

## [1] "Number of data points: 275"
## 
## Not.Signi     Signi 
##       273         2

SLC12A6

## [1] "Number of data points: 309"
## 
## Not.Signi     Signi 
##       308         1

SLC37A1

## [1] "Number of data points: 347"
## 
## Not.Signi     Signi 
##       346         1

SLC3A1

## [1] "Number of data points: 384"
## 
## Not.Signi     Signi 
##       360        24

SLC44A4

## [1] "Number of data points: 957"
## 
## Not.Signi     Signi 
##       682       275

SLC6A19

## [1] "Number of data points: 167"
## 
## Not.Signi 
##       167

TINAG

## [1] "Number of data points: 335"
## 
## Not.Signi     Signi 
##       330         5

TMEM27

## [1] "Number of data points: 80"
## 
## Not.Signi     Signi 
##        79         1

TMPRSS2

## [1] "Number of data points: 227"
## 
## Not.Signi 
##       227

TRPM4

## [1] "Number of data points: 252"
## 
## Not.Signi     Signi 
##       249         3

XPNPEP2

## [1] "Number of data points: 83"
## 
## Not.Signi 
##        83

RORC

## [1] "Number of data points: 527"
## 
## Not.Signi     Signi 
##       503        24

RORA

## [1] "Number of data points: 632"
## 
## Not.Signi     Signi 
##       529       103

RORB

## [1] "Number of data points: 428"
## 
## Not.Signi     Signi 
##       404        24

NR5A2

## [1] "Number of data points: 444"
## 
## Not.Signi     Signi 
##       425        19

NR5A1

## [1] "Number of data points: 255"
## 
## Not.Signi     Signi 
##       241        14

LRRC15

## [1] "Number of data points: 181"
## 
## Not.Signi     Signi 
##       180         1

Gene Prioritization

Distribution of genes for significant traits grouped by domains

Enrichment test for domains

The distribution of genes in immunological domain

The distribution of genes in respiratory domain

The distribution of genes in environmental domain

The distribution of genes in skeletal domain

The distribution of genes in Dermatological domain

The distribution of genes in Connective Tissue domain

Common Genes

## Warning: package 'venn' was built under R version 3.6.3

5. Characterization of SNPs

SNPs that are within +/- 10kb of the gene positions and population frequency (db153; hg19)

##   Variation.ID        dbSNP Chromosome  Position REF.Allele ALT.Allele..IUPAC.
## 1  rs760194105  rs760194105          1 151768549       ATTC                  -
## 2 rs1265893702 rs1265893702          1 151768556          C                  T
## 3 rs1195052699 rs1195052699          1 151768558          A                  G
## 4 rs1488141823 rs1488141823          1 151768564          G                  Y
## 5 rs1202366215 rs1202366215          1 151768566          T                  G
## 6  rs545985998  rs545985998          1 151768567          C                  G
##   Minor.Allele Minor.Allele.Global.Frequency     Contig Contig.Position  Band
## 1         None                          None GL000016.1         3257191 q21.3
## 2         None                          None GL000016.1         3257198 q21.3
## 3         None                          None GL000016.1         3257200 q21.3
## 4         None                          None GL000016.1         3257206 q21.3
## 5         None                          None GL000016.1         3257208 q21.3
## 6            G                      0.000200 GL000016.1         3257209 q21.3

Download full length results here:

Nearest gene annotation

##   Variation.ID Chromosome  Position Overlapped.Gene Type Annotation
## 1         <NA>       <NA>        NA            <NA> <NA>       <NA>
## 2  rs760194105       chr1 151768549            None None       None
## 3 rs1265893702       chr1 151768556            None None       None
## 4 rs1195052699       chr1 151768558            None None       None
## 5 rs1488141823       chr1 151768564            None None       None
## 6 rs1202366215       chr1 151768566            None None       None
##   Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene
## 1                  <NA>                          <NA>
## 2          RP11-98D18.9                     antisense
## 3          RP11-98D18.9                     antisense
## 4          RP11-98D18.9                     antisense
## 5          RP11-98D18.9                     antisense
## 6          RP11-98D18.9                     antisense
##   Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene
## 1                              <NA>                    <NA>
## 2                              1671           RP11-98D18.17
## 3                              1678           RP11-98D18.17
## 4                              1680           RP11-98D18.17
## 5                              1686           RP11-98D18.17
## 6                              1688           RP11-98D18.17
##   Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
## 1                            <NA>                                <NA>
## 2                         lincRNA                                1981
## 3                         lincRNA                                1974
## 4                         lincRNA                                1972
## 5                         lincRNA                                1966
## 6                         lincRNA                                1964

Download full length results here:

CADD Scores

##   Variation.ID Chromosome  Position Variant PHRED
## 1 rs1265893702       chr1 151768556     C/T 13.53
## 2 rs1195052699       chr1 151768558     A/G 12.55
## 3 rs1309532353       chr1 151768828     T/C 15.02
## 4  rs946376285       chr1 151768833     G/A 14.38
## 5 rs1044802297       chr1 151768837     C/T 15.29
## 6  rs903034465       chr1 151768839     G/C 16.03

Download annotation for CADD PHRED score > 10 here:

DeepSEA

##   Variation.ID Chromosome Position Variant Functional.Significance.Score
## 1  rs543482228      chr11   522483     C/T                       0.55310
## 2  rs763218255      chr11   522724     A/T                       0.52076
## 3 rs1381432050      chr11   522725     A/T                       0.53188
## 4 rs1048970710      chr11   522953     T/A                       0.50105
## 5 rs1030030831      chr11   523050     A/G                       0.53433
## 6  rs987669684      chr11   525258     G/A                       0.62874
##   eQTL.Probability GWAS.Probability HGMD.Probability
## 1          0.35134          0.27441          0.36835
## 2          0.37491          0.29143          0.36774
## 3          0.42790          0.30231          0.37801
## 4          0.34974          0.27633          0.37562
## 5          0.41663          0.31488          0.37194
## 6          0.35291          0.24213          0.36358

Download annotation for score > 0.5 :

Enrichment of cluster, disease, function using miRNA targets from SNPs

Cluster

Family

Function

Disease (152 significant observations; top 50 shown in figure)

Top 50 FDR-significant associations are shown in the bar graph and all significant associations are shown in the table listed under the figure

## Selecting by Term.2

6. Neanderthal LA in our COVID-19 ACE2 network SNP set

We compared mean probability of Neanderthal LA between the ACE2 network SNP set (mean=0.032) and 1,000 randomly selected SNP sets with comparable genomic features (range of Neanderthal LA means = 0.027-0.036). The ACE2 network SNP set had significantly greater Neanderthal LA probabilities than 663/1,000 randomly selected SNP sets.

Neanderthal LA in SNPs COVID-19 ACE2 network against randomly selected SNPs

Neanderthal LA in SNPs COVID-19 ACE2 network against randomly selected SNPs

7. SNPs from the COVID19-HGI initiative (Freeze 3) for all six phenotypes

P-value of network-SNPs from from the COVID19-HGI initiative (Freeze 3) for all six phenotypes - https://www.covid19hg.org/results/

A2_V2 (very severe respiratory confirmed covid vs. population; Population -Total Cases= 536 | Total Controls= 329391)

A2_V2

A2_V2

Top 10 lowest P-value of SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
15:60803856:C:T 1.88 × 10−4 0.36074 rs875339 chr15 61096055 RORA protein_coding intronic,non-coding intronic None None None None None None
15:60810211:C:T 8.13 × 10−4 0.31381 rs341419 chr15 61102410 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60822458:C:T 1.45 × 10−3 0.30401 rs10152719 chr15 61114657 RORA protein_coding intronic,non-coding intronic None None None None None None
8:70666606:C:T 1.73 × 10−3 -0.68765 rs113026226 chr8 71578841 LACTB2 protein_coding intronic None None None None None None
15:60817912:G:A 1.74 × 10−3 0.30088 rs12903157 chr15 61110111 RORA protein_coding non-coding intronic,intronic None None None None None None
15:34253720:A:G 1.86 × 10−3 0.28489 rs2705343 chr15 34545921 SLC12A6 protein_coding intronic None None None None None None
15:60820454:C:A 1.92 × 10−3 0.29993 rs12899389 chr15 61112653 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60825666:C:T 2.07 × 10−3 0.28660 rs16943172 chr15 61117865 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60820966:C:T 2.15 × 10−3 0.29404 rs1406667914 chr15 61113160 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60820966:C:T 2.15 × 10−3 0.29404 rs78461015 chr15 61113165 RORA protein_coding non-coding intronic,intronic None None None None None None

CADD Scores

GTEX-eQTLs

rsid gene_id pval_nominal Tissue
rs2705343 ENSG00000128463.12 9.13389e-09 Adipose_Subcutaneous
rs2705343 ENSG00000182117.5 9.44896e-07 Adipose_Subcutaneous
rs2705343 ENSG00000128463.12 1.81195e-05 Adipose_Visceral_Omentum
rs2705343 ENSG00000182117.5 8.06961e-06 Adipose_Visceral_Omentum
rs2705343 ENSG00000128463.12 2.59033e-05 Artery_Aorta
rs2705343 ENSG00000140199.11 1.40008e-11 Artery_Aorta
rs113026226 ENSG00000221947.7 5.89704e-05 Artery_Tibial
rs2705343 ENSG00000134152.10 9.04087e-06 Artery_Tibial
rs2705343 ENSG00000128463.12 9.43125e-09 Artery_Tibial
rs2705343 ENSG00000128463.12 4.65998e-07 Cells_Cultured_fibroblasts
rs2705343 ENSG00000140199.11 2.54972e-08 Cells_Cultured_fibroblasts
rs2705343 ENSG00000128463.12 5.32373e-07 Colon_Sigmoid
rs2705343 ENSG00000128463.12 5.18709e-08 Esophagus_Gastroesophageal_Junction
rs2705343 ENSG00000128463.12 5.11224e-20 Esophagus_Mucosa
rs2705343 ENSG00000140199.11 1.47766e-18 Esophagus_Mucosa
rs113026226 ENSG00000221947.7 1.38624e-04 Esophagus_Muscularis
rs2705343 ENSG00000128463.12 2.10740e-08 Esophagus_Muscularis
rs2705343 ENSG00000182117.5 4.99233e-05 Esophagus_Muscularis
rs2705343 ENSG00000182117.5 2.01836e-07 Heart_Left_Ventricle
rs2705343 ENSG00000182117.5 1.82788e-12 Lung
rs113026226 ENSG00000221947.7 1.75744e-06 Muscle_Skeletal
rs2705343 ENSG00000128463.12 4.72857e-06 Muscle_Skeletal
rs2705343 ENSG00000140199.11 2.76234e-06 Muscle_Skeletal
rs2705343 ENSG00000182117.5 5.54404e-25 Muscle_Skeletal
rs2705343 ENSG00000128463.12 1.93078e-08 Nerve_Tibial
rs2705343 ENSG00000140199.11 6.22189e-05 Nerve_Tibial
rs2705343 ENSG00000128463.12 1.41336e-11 Skin_Not_Sun_Exposed_Suprapubic
rs2705343 ENSG00000140199.11 2.54975e-07 Skin_Not_Sun_Exposed_Suprapubic
rs113026226 ENSG00000221947.7 1.29050e-05 Skin_Sun_Exposed_Lower_leg
rs2705343 ENSG00000128463.12 4.43092e-10 Skin_Sun_Exposed_Lower_leg
rs2705343 ENSG00000140199.11 6.09070e-05 Skin_Sun_Exposed_Lower_leg
rs2705343 ENSG00000128463.12 2.22679e-06 Spleen
rs2705343 ENSG00000182117.5 1.60123e-09 Spleen
rs2705343 ENSG00000140199.11 1.58268e-11 Testis
rs2705343 ENSG00000128463.12 1.56088e-07 Thyroid
rs2705343 ENSG00000140199.11 7.01860e-16 Thyroid
rs2705343 ENSG00000134152.10 3.01523e-05 Whole_Blood
rs2705343 ENSG00000182117.5 6.16437e-28 Whole_Blood

mQTLs (cis and trans)

B1_V2 Phenotype (hospitalized covid vs. not hospitalized covid; Population Total Cases - 928 | Total Controls - 2028)

B1_V2

B1_V2

Top 10 lowest SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
1:200092745:A:G 2.81 × 10−5 -0.73277 rs3790826 chr1 200061873 NR5A2 protein_coding intronic None None None None None None
3:10277484:C:T 4.67 × 10−5 -0.83174 rs115313152 chr3 10319168 TATDN2 protein_coding intronic,non-coding intronic None None None None None None
3:10277484:C:T 4.67 × 10−5 -0.83174 rs115313152 chr3 10319168 RP11-438J1.1 protein_coding intronic None None None None None None
1:86481385:C:T 1.09 × 10−4 0.77155 rs5744352 chr1 86947068 CLCA1 protein_coding intronic None None None None None None
3:194378110:G:A 1.74 × 10−4 -0.62045 rs143975519 chr3 194098839 None None None LRRC15 protein_coding 8367 GP5 protein_coding 16711
5:1211624:A:G 2.52 × 10−4 0.51892 rs76067074 chr5 1211739 SLC6A19 protein_coding intronic None None None None None None
18:32200733:G:A 2.56 × 10−4 -2.12170 rs146307802 chr18 29780696 GAREM protein_coding intronic None None None None None None
18:32200733:G:A 2.56 × 10−4 -2.12170 rs146307802 chr18 29780696 MEP1B protein_coding intronic,non-coding intronic None None None None None None
5:1215359:G:A 3.15 × 10−4 0.33416 rs11133684 chr5 1215474 SLC6A19 protein_coding intronic None None None None None None
13:103068707:C:G 3.62 × 10−4 -1.99870 rs61966076 chr13 103721057 None None None SLC10A2 protein_coding 1861 RP11-123H22.1 lincRNA 356493
13:103049298:A:G 3.89 × 10−4 -1.96380 rs61966074 chr13 103701648 SLC10A2 protein_coding coding nonsyn None None None None None None
14:90416597:A:G 4.16 × 10−4 -1.39440 rs78610223 chr14 90882941 None None None CALM1 protein_coding 8336 RP11-1078H9.1 lincRNA 35466

CADD Scores

GTEX-eQTLs

rsid gene_id pval_nominal Tissue
rs115313152 ENSG00000231177.4 6.62376e-06 Cells_Cultured_fibroblasts
rs78610223 ENSG00000100784.10 6.86986e-06 Cells_Cultured_fibroblasts

mQTLs (cis and trans)

B2_V2 Phenotype (hospitalized covid vs. population; Population Total Cases - 3199 | Total Controls - 897488)

B2_V2 hospitalized covid (n=3199) vs. population (n=897488)

B2_V2 hospitalized covid (n=3199) vs. population (n=897488)

Top 10 lowest SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
15:60845514:G:A 2.75 × 10−5 0.15168 rs17303202 chr15 61137713 RORA protein_coding non-coding intronic,intronic None None None None None None
10:72931692:A:G 8.27 × 10−5 0.41731 rs117501894 chr10 74691450 OIT3 protein_coding intronic None None None None None None
15:60879331:T:C 4.40 × 10−4 0.11702 rs1482060 chr15 61171530 RORA protein_coding intronic,non-coding intronic None None None None None None
15:61197617:G:A 4.80 × 10−4 0.59610 rs117605488 chr15 61489816 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60867245:C:T 5.69 × 10−4 0.12355 rs72750668 chr15 61159444 RORA protein_coding non-coding intronic,intronic None None None None None None
2:86466350:C:A 5.78 × 10−4 2.14360 rs200859016 chr2 86693473 KDM3A protein_coding intronic,5upstream,non-coding intronic None None None None None None
15:61081664:C:T 6.70 × 10−4 1.19640 rs555160850 chr15 61373863 RORA protein_coding intronic,non-coding intronic None None None None None None
15:60522867:C:T 6.95 × 10−4 2.13780 rs576742037 chr15 60815066 RP11-219B17.1 antisense non-coding intronic None None None None None None
15:60522867:C:T 6.95 × 10−4 2.13780 rs576742037 chr15 60815066 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60880369:G:A 8.20 × 10−4 0.11153 rs7182717 chr15 61172568 RORA protein_coding intronic,non-coding intronic None None None None None None
1:200185981:T:C 8.41 × 10−4 1.25170 rs192505301 chr1 200155109 None None None NR5A2 protein_coding 8557 FAM58BP pseudogene 27547

CADD Scores

GTEX-eQTLs (cis)

rsid gene_id pval_nominal Tissue
rs117501894 ENSG00000166295.8 1.18660e-05 Artery_Aorta
rs117501894 ENSG00000166295.8 8.96870e-07 Artery_Tibial
rs117501894 ENSG00000166295.8 1.13816e-07 Brain_Caudate_basal_ganglia
rs117501894 ENSG00000148719.14 5.47445e-05 Brain_Cerebellar_Hemisphere
rs117501894 ENSG00000166295.8 4.36824e-06 Brain_Cortex
rs117501894 ENSG00000166295.8 6.34330e-08 Esophagus_Muscularis
rs117501894 ENSG00000166295.8 1.70936e-06 Lung
rs117501894 ENSG00000148719.14 1.46215e-04 Muscle_Skeletal
rs117501894 ENSG00000166295.8 8.06329e-05 Nerve_Tibial
rs117501894 ENSG00000222047.8 1.67934e-04 Skin_Sun_Exposed_Lower_leg
rs117501894 ENSG00000166295.8 3.99610e-07 Thyroid

mQTLs (cis and trans)

Variation.ID Overlapped.Gene Trait_chr Trait_start Trait_end Mapped_gene Pvalue Tissue Population PMID
rs17303202 RORA 17 78163790 78163790 CARD14 7.59 × 10−8 Blood EUR 27036880

C1_V2 Phenotype (covid vs. lab/self-reported negative; Population Total Cases - 3523 | Total Controls - 36634)

C1_V2

C1_V2

Top 10 lowest SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
1:200180979:C:T 5.19 × 10−5 3.09390 rs144399166 chr1 200150107 None None None NR5A2 protein_coding 3555 FAM58BP pseudogene 32549
15:60902209:A:G 8.25 × 10−5 0.12511 rs4774377 chr15 61194408 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60902607:T:C 8.83 × 10−5 0.12455 rs877863 chr15 61194806 RORA protein_coding non-coding intronic,intronic None None None None None None
15:34305621:T:A 9.65 × 10−5 0.31300 rs767828673 chr15 34597819 SLC12A6 protein_coding intronic None None None None None None
15:34305621:T:A 9.65 × 10−5 0.31300 rs77806292 chr15 34597822 SLC12A6 protein_coding intronic None None None None None None
6:54396894:AT:A 1.13 × 10−4 4.68550 rs1219949521 chr6 54261692 None None None TINAG protein_coding 6742 CLNS1AP1 pseudogene 88275
15:60896319:C:G 1.14 × 10−4 0.12329 rs4775313 chr15 61188518 RORA protein_coding intronic,non-coding intronic None None None None None None
15:34317573:G:A 1.19 × 10−4 0.32204 rs145719616 chr15 34609774 SLC12A6 protein_coding intronic None None None None None None
15:60895805:T:C 1.28 × 10−4 0.14405 rs11071566 chr15 61188004 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60802914:C:A 1.82 × 10−4 0.96862 rs143746632 chr15 61095113 RORA protein_coding non-coding intronic,intronic None None None None None None

CADD Scores

Variation.ID PHRED
rs1219949521 0.537
rs77806292 0.706
rs145719616 0.225
rs143746632 6.598
rs11071566 3.763
rs4775313 7.355
rs4774377 6.006
rs877863 1.697
rs144399166 8.465

GTEX-eQTLs

rsid gene_id pval_nominal Tissue
rs77806292 ENSG00000140199.11 5.65605e-09 Esophagus_Mucosa
rs145719616 ENSG00000140199.11 2.10656e-08 Esophagus_Mucosa

mQTLs (cis and trans)

Variation.ID Overlapped.Gene Trait_chr Trait_start Trait_end Mapped_gene Pvalue Tissue Population PMID
rs77806292 SLC12A6 15 34502498 34502498 KATNBL1 5.97 × 10−9 Blood EUR 27036880
rs145719616 SLC12A6 15 34502498 34502498 KATNBL1 1.22 × 10−8 Blood EUR 27036880
rs4775313 RORA 15 61195735 61195735 NULL 1.39 × 10−18 Blood EUR 26699738
rs4774377 RORA 15 61194101 61194101 NULL 2.15 × 10−8 Blood EUR 26699738
rs4774377 RORA 15 61195846 61195846 NULL 1.60 × 10−7 Blood EUR 26699738
rs877863 RORA 15 61194218 61194218 NULL 6.34 × 10−30 Blood EUR 26699738

C2_V2 Phenotype (covid vs. population; Population Total Cases - 6696 | Total Controls - 1073072)

C2_V2

C2_V2

Top 10 lowest SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
6:54352169:C:T 3.53 × 10−6 0.317670 rs72959316 chr6 54216967 TINAG protein_coding intronic None None None None None None
15:60845514:G:A 2.35 × 10−5 0.098117 rs17303202 chr15 61137713 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60652816:T:C 9.50 × 10−5 0.109130 rs17237318 chr15 60945015 RORA protein_coding intronic,non-coding intronic None None None None None None
15:60963161:C:T 1.13 × 10−4 5.922400 rs190295359 chr15 61255360 RORA protein_coding non-coding intronic,intronic None None None None None None
15:60580912:G:A 1.15 × 10−4 0.101800 rs340002 chr15 60873111 RP11-219B17.1 antisense non-coding intronic None None None None None None
15:60580912:G:A 1.15 × 10−4 0.101800 rs340002 chr15 60873111 RORA protein_coding non-coding intronic,intronic None None None None None None
8:70677171:G:GGTCTCACTTTGTTGCCCAGTCTGGAGTGCAGCGAT 2.16 × 10−4 0.571820 rs1193443704 chr8 71589406 XKR9 protein_coding intronic,non-coding intronic None None None None None None
15:60655668:A:G 2.53 × 10−4 0.101010 rs56999424 chr15 60947867 RORA protein_coding non-coding intronic,intronic None None None None None None
1:167300839:C:T 2.75 × 10−4 0.331330 rs150845001 chr1 167270076 POU2F1 protein_coding non-coding intronic,intronic None None None None None None
15:60577007:A:T 3.58 × 10−4 -0.092052 rs12912196 chr15 60869206 RP11-219B17.1 antisense non-coding intronic None None None None None None
15:60577007:A:T 3.58 × 10−4 -0.092052 rs12912196 chr15 60869206 RORA protein_coding non-coding intronic,intronic None None None None None None
1:167339162:C:T 4.05 × 10−4 0.315180 rs76244803 chr1 167308399 POU2F1 protein_coding intronic,non-coding intronic None None None None None None

GTEX-eQTLs

rsid gene_id pval_nominal Tissue
rs150845001 ENSG00000143162.7 4.62926e-06 Brain_Amygdala
rs76244803 ENSG00000143162.7 4.62926e-06 Brain_Amygdala
rs150845001 ENSG00000225171.2 1.25359e-05 Esophagus_Gastroesophageal_Junction
rs76244803 ENSG00000225171.2 1.25359e-05 Esophagus_Gastroesophageal_Junction
rs12912196 ENSG00000069667.15 3.89608e-05 Pancreas

mQTLs (cis and trans)

Variation.ID Overlapped.Gene Trait_chr Trait_start Trait_end Mapped_gene Pvalue Tissue Population PMID
rs17303202 RORA 17 78163790 78163790 CARD14 7.59 × 10−8 Blood EUR 27036880
rs12912196 RP11-219B17.1 16 740572 740572 WDR24 2.57 × 10−8 Blood EUR 27036880
rs12912196 RP11-219B17.1 15 60690667 60690667 ANXA2 7.84 × 10−7 Blood EAS 29476079
rs12912196 RORA 16 740572 740572 WDR24 2.57 × 10−8 Blood EUR 27036880
rs12912196 RORA 15 60690667 60690667 ANXA2 7.84 × 10−7 Blood EAS 29476079

D1_V2 Phenotype (predicted covid from self-reported symptoms vs. predicted or self-reported non-covid; Population Total Cases - 1865 | Total Controls - 29174)

D1_V2

D1_V2

Top 10 lowest SNPs from the network

SNP_hg38 Pvalue Beta RSIDs Chromosome Position Overlapped.Gene Type Annotation Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
3:155148344:C:T 3.28 × 10−4 2.56820 rs61758206 chr3 154866133 MME protein_coding intronic None None None None None None
6:46816273:A:T 5.36 × 10−4 1.05850 rs114538502 chr6 46784010 MEP1A protein_coding intronic None None None None None None
19:18444382:C:T 5.85 × 10−4 5.71260 rs535476624 chr19 18555192 ELL protein_coding 3downstream,3utr None None None None None None
1:167387443:C:T 1.02 × 10−3 6.68660 rs12127704 chr1 167356680 POU2F1 protein_coding non-coding intronic,intronic,3downstream None None None None None None
15:60573782:G:A 1.14 × 10−3 5.41050 rs563560240 chr15 60865981 RP11-219B17.1 antisense non-coding intronic None None None None None None
15:60573782:G:A 1.14 × 10−3 5.41050 rs563560240 chr15 60865981 RORA protein_coding non-coding intronic,intronic None None None None None None
21:42686952:G:C 1.37 × 10−3 1.77810 rs551395849 chr21 44107062 PDE9A protein_coding intronic,non-coding intronic None None None None None None
8:7065086:C:T 1.61 × 10−3 -0.50667 rs117847654 chr8 6922608 None None None DEFA5 protein_coding 8352 AF238378.7 pseudogene 17885
2:161997917:G:A 1.99 × 10−3 0.49781 rs16846230 chr2 162854427 DPP4 protein_coding intronic,non-coding intronic None None None None None None
2:162022259:C:T 2.15 × 10−3 0.48864 rs3788980 chr2 162878769 DPP4 protein_coding 5upstream,non-coding intronic,intronic None None None None None None
3:155063868:A:G 2.35 × 10−3 0.18116 rs10446333 chr3 154781657 MME protein_coding intronic None None None None None None

CADD Scores

Variation.ID PHRED
rs535476624 16.060
rs10446333 7.243
rs114538502 0.003
rs12127704 2.323
rs563560240 4.818
rs551395849 1.079
rs61758206 2.784
rs16846230 0.438
rs3788980 1.552
rs117847654 0.652

GTEX-eQTLs

rsid gene_id pval_nominal Tissue

mQTLs (cis and trans)

Variation.ID Overlapped.Gene Trait_chr Trait_start Trait_end Mapped_gene Pvalue Tissue Population PMID
rs16846230 DPP4 24 21239607 21239607 TTTY14 1.48 × 10−11 Blood EUR 27036880
rs16846230 DPP4 24 2655942 2655942 SRY 1.35 × 10−8 Blood EUR 27036880
rs16846230 DPP4 24 2708972 2708972 RPS4Y1 1.41 × 10−10 Blood EUR 27036880
rs3788980 DPP4 24 21239607 21239607 TTTY14 1.36 × 10−10 Blood EUR 27036880
rs3788980 DPP4 24 27009430 27009430 DAZ2 1.80 × 10−10 Blood EUR 27036880
rs3788980 DPP4 24 2708972 2708972 RPS4Y1 8.75 × 10−10 Blood EUR 27036880
rs3788980 DPP4 7 158339017 158339017 PTPRN2 5.20 × 10−8 Blood EUR 27036880
rs3788980 DPP4 24 8553009 8553009 TTTY18 8.44 × 10−12 Blood EUR 27036880
rs117847654 None 24 6742689 6742689 AMELY 3.20 × 10−8 Blood EUR 27036880