## Cache found
Tissue enrichment of all genes (analyzed in FUMA)
Table for above graph
Pathway based similarity of drugs
## [1] "Number of data points: 245"
##
## Not.Signi Signi
## 203 42
## [1] "Number of data points: 323"
##
## Not.Signi Signi
## 300 23
## [1] "Number of data points: 64"
##
## Not.Signi
## 64
## [1] "Number of data points: 240"
##
## Not.Signi Signi
## 239 1
## [1] "Number of data points: 393"
##
## Not.Signi Signi
## 380 13
## [1] "Number of data points: 401"
##
## Not.Signi Signi
## 296 105
## [1] "Number of data points: 267"
##
## Not.Signi Signi
## 265 2
## [1] "Number of data points: 259"
##
## Not.Signi
## 259
## [1] "Number of data points: 247"
##
## Not.Signi Signi
## 237 10
## [1] "Number of data points: 228"
##
## Not.Signi Signi
## 226 2
## [1] "Number of data points: 324"
##
## Not.Signi Signi
## 322 2
## [1] "Number of data points: 223"
##
## Not.Signi Signi
## 212 11
## [1] "Number of data points: 218"
##
## Not.Signi
## 218
## [1] "Number of data points: 466"
##
## Not.Signi Signi
## 400 66
## [1] "Number of data points: 477"
##
## Not.Signi Signi
## 431 46
## [1] "Number of data points: 260"
##
## Not.Signi Signi
## 258 2
## [1] "Number of data points: 422"
##
## Not.Signi Signi
## 382 40
## [1] "Number of data points: 314"
##
## Not.Signi Signi
## 311 3
## [1] "Number of data points: 226"
##
## Not.Signi Signi
## 224 2
## [1] "Number of data points: 425"
##
## Not.Signi Signi
## 393 32
## [1] "Number of data points: 256"
##
## Not.Signi
## 256
## [1] "Number of data points: 342"
##
## Not.Signi Signi
## 292 50
## [1] "Number of data points: 376"
##
## Not.Signi Signi
## 357 19
## [1] "Number of data points: 269"
##
## Not.Signi Signi
## 266 3
## [1] "Number of data points: 243"
##
## Not.Signi
## 243
## [1] "Number of data points: 237"
##
## Not.Signi Signi
## 236 1
## [1] "Number of data points: 296"
##
## Not.Signi Signi
## 294 2
## [1] "Number of data points: 196"
##
## Not.Signi Signi
## 195 1
## [1] "Number of data points: 366"
##
## Not.Signi Signi
## 360 6
## [1] "Number of data points: 307"
##
## Not.Signi Signi
## 302 5
## [1] "Number of data points: 314"
##
## Not.Signi Signi
## 307 7
## [1] "Number of data points: 313"
##
## Not.Signi Signi
## 308 5
## [1] "Number of data points: 257"
##
## Not.Signi Signi
## 254 3
## [1] "Number of data points: 217"
##
## Not.Signi Signi
## 216 1
## [1] "Number of data points: 275"
##
## Not.Signi Signi
## 273 2
## [1] "Number of data points: 309"
##
## Not.Signi Signi
## 308 1
## [1] "Number of data points: 347"
##
## Not.Signi Signi
## 346 1
## [1] "Number of data points: 384"
##
## Not.Signi Signi
## 360 24
## [1] "Number of data points: 957"
##
## Not.Signi Signi
## 682 275
## [1] "Number of data points: 167"
##
## Not.Signi
## 167
## [1] "Number of data points: 335"
##
## Not.Signi Signi
## 330 5
## [1] "Number of data points: 80"
##
## Not.Signi Signi
## 79 1
## [1] "Number of data points: 227"
##
## Not.Signi
## 227
## [1] "Number of data points: 252"
##
## Not.Signi Signi
## 249 3
## [1] "Number of data points: 83"
##
## Not.Signi
## 83
## [1] "Number of data points: 527"
##
## Not.Signi Signi
## 503 24
## [1] "Number of data points: 632"
##
## Not.Signi Signi
## 529 103
## [1] "Number of data points: 428"
##
## Not.Signi Signi
## 404 24
## [1] "Number of data points: 444"
##
## Not.Signi Signi
## 425 19
## [1] "Number of data points: 255"
##
## Not.Signi Signi
## 241 14
## [1] "Number of data points: 181"
##
## Not.Signi Signi
## 180 1
## Warning: package 'venn' was built under R version 3.6.3
## Variation.ID dbSNP Chromosome Position REF.Allele ALT.Allele..IUPAC.
## 1 rs760194105 rs760194105 1 151768549 ATTC -
## 2 rs1265893702 rs1265893702 1 151768556 C T
## 3 rs1195052699 rs1195052699 1 151768558 A G
## 4 rs1488141823 rs1488141823 1 151768564 G Y
## 5 rs1202366215 rs1202366215 1 151768566 T G
## 6 rs545985998 rs545985998 1 151768567 C G
## Minor.Allele Minor.Allele.Global.Frequency Contig Contig.Position Band
## 1 None None GL000016.1 3257191 q21.3
## 2 None None GL000016.1 3257198 q21.3
## 3 None None GL000016.1 3257200 q21.3
## 4 None None GL000016.1 3257206 q21.3
## 5 None None GL000016.1 3257208 q21.3
## 6 G 0.000200 GL000016.1 3257209 q21.3
Download full length results here:
## Variation.ID Chromosome Position Overlapped.Gene Type Annotation
## 1 <NA> <NA> NA <NA> <NA> <NA>
## 2 rs760194105 chr1 151768549 None None None
## 3 rs1265893702 chr1 151768556 None None None
## 4 rs1195052699 chr1 151768558 None None None
## 5 rs1488141823 chr1 151768564 None None None
## 6 rs1202366215 chr1 151768566 None None None
## Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene
## 1 <NA> <NA>
## 2 RP11-98D18.9 antisense
## 3 RP11-98D18.9 antisense
## 4 RP11-98D18.9 antisense
## 5 RP11-98D18.9 antisense
## 6 RP11-98D18.9 antisense
## Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene
## 1 <NA> <NA>
## 2 1671 RP11-98D18.17
## 3 1678 RP11-98D18.17
## 4 1680 RP11-98D18.17
## 5 1686 RP11-98D18.17
## 6 1688 RP11-98D18.17
## Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
## 1 <NA> <NA>
## 2 lincRNA 1981
## 3 lincRNA 1974
## 4 lincRNA 1972
## 5 lincRNA 1966
## 6 lincRNA 1964
Download full length results here:
## Variation.ID Chromosome Position Variant PHRED
## 1 rs1265893702 chr1 151768556 C/T 13.53
## 2 rs1195052699 chr1 151768558 A/G 12.55
## 3 rs1309532353 chr1 151768828 T/C 15.02
## 4 rs946376285 chr1 151768833 G/A 14.38
## 5 rs1044802297 chr1 151768837 C/T 15.29
## 6 rs903034465 chr1 151768839 G/C 16.03
Download annotation for CADD PHRED score > 10 here:
## Variation.ID Chromosome Position Variant Functional.Significance.Score
## 1 rs543482228 chr11 522483 C/T 0.55310
## 2 rs763218255 chr11 522724 A/T 0.52076
## 3 rs1381432050 chr11 522725 A/T 0.53188
## 4 rs1048970710 chr11 522953 T/A 0.50105
## 5 rs1030030831 chr11 523050 A/G 0.53433
## 6 rs987669684 chr11 525258 G/A 0.62874
## eQTL.Probability GWAS.Probability HGMD.Probability
## 1 0.35134 0.27441 0.36835
## 2 0.37491 0.29143 0.36774
## 3 0.42790 0.30231 0.37801
## 4 0.34974 0.27633 0.37562
## 5 0.41663 0.31488 0.37194
## 6 0.35291 0.24213 0.36358
Download annotation for score > 0.5 :
Top 50 FDR-significant associations are shown in the bar graph and all significant associations are shown in the table listed under the figure
## Selecting by Term.2
We compared mean probability of Neanderthal LA between the ACE2 network SNP set (mean=0.032) and 1,000 randomly selected SNP sets with comparable genomic features (range of Neanderthal LA means = 0.027-0.036). The ACE2 network SNP set had significantly greater Neanderthal LA probabilities than 663/1,000 randomly selected SNP sets.
Neanderthal LA in SNPs COVID-19 ACE2 network against randomly selected SNPs
P-value of network-SNPs from from the COVID19-HGI initiative (Freeze 3) for all six phenotypes - https://www.covid19hg.org/results/
A2_V2
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 15:60803856:C:T | 1.88 × 10−4 | 0.36074 | rs875339 | chr15 | 61096055 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:60810211:C:T | 8.13 × 10−4 | 0.31381 | rs341419 | chr15 | 61102410 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60822458:C:T | 1.45 × 10−3 | 0.30401 | rs10152719 | chr15 | 61114657 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 8:70666606:C:T | 1.73 × 10−3 | -0.68765 | rs113026226 | chr8 | 71578841 | LACTB2 | protein_coding | intronic | None | None | None | None | None | None |
| 15:60817912:G:A | 1.74 × 10−3 | 0.30088 | rs12903157 | chr15 | 61110111 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:34253720:A:G | 1.86 × 10−3 | 0.28489 | rs2705343 | chr15 | 34545921 | SLC12A6 | protein_coding | intronic | None | None | None | None | None | None |
| 15:60820454:C:A | 1.92 × 10−3 | 0.29993 | rs12899389 | chr15 | 61112653 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60825666:C:T | 2.07 × 10−3 | 0.28660 | rs16943172 | chr15 | 61117865 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60820966:C:T | 2.15 × 10−3 | 0.29404 | rs1406667914 | chr15 | 61113160 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60820966:C:T | 2.15 × 10−3 | 0.29404 | rs78461015 | chr15 | 61113165 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| rsid | gene_id | pval_nominal | Tissue |
|---|---|---|---|
| rs2705343 | ENSG00000128463.12 | 9.13389e-09 | Adipose_Subcutaneous |
| rs2705343 | ENSG00000182117.5 | 9.44896e-07 | Adipose_Subcutaneous |
| rs2705343 | ENSG00000128463.12 | 1.81195e-05 | Adipose_Visceral_Omentum |
| rs2705343 | ENSG00000182117.5 | 8.06961e-06 | Adipose_Visceral_Omentum |
| rs2705343 | ENSG00000128463.12 | 2.59033e-05 | Artery_Aorta |
| rs2705343 | ENSG00000140199.11 | 1.40008e-11 | Artery_Aorta |
| rs113026226 | ENSG00000221947.7 | 5.89704e-05 | Artery_Tibial |
| rs2705343 | ENSG00000134152.10 | 9.04087e-06 | Artery_Tibial |
| rs2705343 | ENSG00000128463.12 | 9.43125e-09 | Artery_Tibial |
| rs2705343 | ENSG00000128463.12 | 4.65998e-07 | Cells_Cultured_fibroblasts |
| rs2705343 | ENSG00000140199.11 | 2.54972e-08 | Cells_Cultured_fibroblasts |
| rs2705343 | ENSG00000128463.12 | 5.32373e-07 | Colon_Sigmoid |
| rs2705343 | ENSG00000128463.12 | 5.18709e-08 | Esophagus_Gastroesophageal_Junction |
| rs2705343 | ENSG00000128463.12 | 5.11224e-20 | Esophagus_Mucosa |
| rs2705343 | ENSG00000140199.11 | 1.47766e-18 | Esophagus_Mucosa |
| rs113026226 | ENSG00000221947.7 | 1.38624e-04 | Esophagus_Muscularis |
| rs2705343 | ENSG00000128463.12 | 2.10740e-08 | Esophagus_Muscularis |
| rs2705343 | ENSG00000182117.5 | 4.99233e-05 | Esophagus_Muscularis |
| rs2705343 | ENSG00000182117.5 | 2.01836e-07 | Heart_Left_Ventricle |
| rs2705343 | ENSG00000182117.5 | 1.82788e-12 | Lung |
| rs113026226 | ENSG00000221947.7 | 1.75744e-06 | Muscle_Skeletal |
| rs2705343 | ENSG00000128463.12 | 4.72857e-06 | Muscle_Skeletal |
| rs2705343 | ENSG00000140199.11 | 2.76234e-06 | Muscle_Skeletal |
| rs2705343 | ENSG00000182117.5 | 5.54404e-25 | Muscle_Skeletal |
| rs2705343 | ENSG00000128463.12 | 1.93078e-08 | Nerve_Tibial |
| rs2705343 | ENSG00000140199.11 | 6.22189e-05 | Nerve_Tibial |
| rs2705343 | ENSG00000128463.12 | 1.41336e-11 | Skin_Not_Sun_Exposed_Suprapubic |
| rs2705343 | ENSG00000140199.11 | 2.54975e-07 | Skin_Not_Sun_Exposed_Suprapubic |
| rs113026226 | ENSG00000221947.7 | 1.29050e-05 | Skin_Sun_Exposed_Lower_leg |
| rs2705343 | ENSG00000128463.12 | 4.43092e-10 | Skin_Sun_Exposed_Lower_leg |
| rs2705343 | ENSG00000140199.11 | 6.09070e-05 | Skin_Sun_Exposed_Lower_leg |
| rs2705343 | ENSG00000128463.12 | 2.22679e-06 | Spleen |
| rs2705343 | ENSG00000182117.5 | 1.60123e-09 | Spleen |
| rs2705343 | ENSG00000140199.11 | 1.58268e-11 | Testis |
| rs2705343 | ENSG00000128463.12 | 1.56088e-07 | Thyroid |
| rs2705343 | ENSG00000140199.11 | 7.01860e-16 | Thyroid |
| rs2705343 | ENSG00000134152.10 | 3.01523e-05 | Whole_Blood |
| rs2705343 | ENSG00000182117.5 | 6.16437e-28 | Whole_Blood |
B1_V2
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1:200092745:A:G | 2.81 × 10−5 | -0.73277 | rs3790826 | chr1 | 200061873 | NR5A2 | protein_coding | intronic | None | None | None | None | None | None |
| 3:10277484:C:T | 4.67 × 10−5 | -0.83174 | rs115313152 | chr3 | 10319168 | TATDN2 | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 3:10277484:C:T | 4.67 × 10−5 | -0.83174 | rs115313152 | chr3 | 10319168 | RP11-438J1.1 | protein_coding | intronic | None | None | None | None | None | None |
| 1:86481385:C:T | 1.09 × 10−4 | 0.77155 | rs5744352 | chr1 | 86947068 | CLCA1 | protein_coding | intronic | None | None | None | None | None | None |
| 3:194378110:G:A | 1.74 × 10−4 | -0.62045 | rs143975519 | chr3 | 194098839 | None | None | None | LRRC15 | protein_coding | 8367 | GP5 | protein_coding | 16711 |
| 5:1211624:A:G | 2.52 × 10−4 | 0.51892 | rs76067074 | chr5 | 1211739 | SLC6A19 | protein_coding | intronic | None | None | None | None | None | None |
| 18:32200733:G:A | 2.56 × 10−4 | -2.12170 | rs146307802 | chr18 | 29780696 | GAREM | protein_coding | intronic | None | None | None | None | None | None |
| 18:32200733:G:A | 2.56 × 10−4 | -2.12170 | rs146307802 | chr18 | 29780696 | MEP1B | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 5:1215359:G:A | 3.15 × 10−4 | 0.33416 | rs11133684 | chr5 | 1215474 | SLC6A19 | protein_coding | intronic | None | None | None | None | None | None |
| 13:103068707:C:G | 3.62 × 10−4 | -1.99870 | rs61966076 | chr13 | 103721057 | None | None | None | SLC10A2 | protein_coding | 1861 | RP11-123H22.1 | lincRNA | 356493 |
| 13:103049298:A:G | 3.89 × 10−4 | -1.96380 | rs61966074 | chr13 | 103701648 | SLC10A2 | protein_coding | coding nonsyn | None | None | None | None | None | None |
| 14:90416597:A:G | 4.16 × 10−4 | -1.39440 | rs78610223 | chr14 | 90882941 | None | None | None | CALM1 | protein_coding | 8336 | RP11-1078H9.1 | lincRNA | 35466 |
| rsid | gene_id | pval_nominal | Tissue |
|---|---|---|---|
| rs115313152 | ENSG00000231177.4 | 6.62376e-06 | Cells_Cultured_fibroblasts |
| rs78610223 | ENSG00000100784.10 | 6.86986e-06 | Cells_Cultured_fibroblasts |
B2_V2 hospitalized covid (n=3199) vs. population (n=897488)
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 15:60845514:G:A | 2.75 × 10−5 | 0.15168 | rs17303202 | chr15 | 61137713 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 10:72931692:A:G | 8.27 × 10−5 | 0.41731 | rs117501894 | chr10 | 74691450 | OIT3 | protein_coding | intronic | None | None | None | None | None | None |
| 15:60879331:T:C | 4.40 × 10−4 | 0.11702 | rs1482060 | chr15 | 61171530 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:61197617:G:A | 4.80 × 10−4 | 0.59610 | rs117605488 | chr15 | 61489816 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60867245:C:T | 5.69 × 10−4 | 0.12355 | rs72750668 | chr15 | 61159444 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 2:86466350:C:A | 5.78 × 10−4 | 2.14360 | rs200859016 | chr2 | 86693473 | KDM3A | protein_coding | intronic,5upstream,non-coding intronic | None | None | None | None | None | None |
| 15:61081664:C:T | 6.70 × 10−4 | 1.19640 | rs555160850 | chr15 | 61373863 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:60522867:C:T | 6.95 × 10−4 | 2.13780 | rs576742037 | chr15 | 60815066 | RP11-219B17.1 | antisense | non-coding intronic | None | None | None | None | None | None |
| 15:60522867:C:T | 6.95 × 10−4 | 2.13780 | rs576742037 | chr15 | 60815066 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60880369:G:A | 8.20 × 10−4 | 0.11153 | rs7182717 | chr15 | 61172568 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 1:200185981:T:C | 8.41 × 10−4 | 1.25170 | rs192505301 | chr1 | 200155109 | None | None | None | NR5A2 | protein_coding | 8557 | FAM58BP | pseudogene | 27547 |
| rsid | gene_id | pval_nominal | Tissue |
|---|---|---|---|
| rs117501894 | ENSG00000166295.8 | 1.18660e-05 | Artery_Aorta |
| rs117501894 | ENSG00000166295.8 | 8.96870e-07 | Artery_Tibial |
| rs117501894 | ENSG00000166295.8 | 1.13816e-07 | Brain_Caudate_basal_ganglia |
| rs117501894 | ENSG00000148719.14 | 5.47445e-05 | Brain_Cerebellar_Hemisphere |
| rs117501894 | ENSG00000166295.8 | 4.36824e-06 | Brain_Cortex |
| rs117501894 | ENSG00000166295.8 | 6.34330e-08 | Esophagus_Muscularis |
| rs117501894 | ENSG00000166295.8 | 1.70936e-06 | Lung |
| rs117501894 | ENSG00000148719.14 | 1.46215e-04 | Muscle_Skeletal |
| rs117501894 | ENSG00000166295.8 | 8.06329e-05 | Nerve_Tibial |
| rs117501894 | ENSG00000222047.8 | 1.67934e-04 | Skin_Sun_Exposed_Lower_leg |
| rs117501894 | ENSG00000166295.8 | 3.99610e-07 | Thyroid |
| Variation.ID | Overlapped.Gene | Trait_chr | Trait_start | Trait_end | Mapped_gene | Pvalue | Tissue | Population | PMID |
|---|---|---|---|---|---|---|---|---|---|
| rs17303202 | RORA | 17 | 78163790 | 78163790 | CARD14 | 7.59 × 10−8 | Blood | EUR | 27036880 |
C1_V2
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1:200180979:C:T | 5.19 × 10−5 | 3.09390 | rs144399166 | chr1 | 200150107 | None | None | None | NR5A2 | protein_coding | 3555 | FAM58BP | pseudogene | 32549 |
| 15:60902209:A:G | 8.25 × 10−5 | 0.12511 | rs4774377 | chr15 | 61194408 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60902607:T:C | 8.83 × 10−5 | 0.12455 | rs877863 | chr15 | 61194806 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:34305621:T:A | 9.65 × 10−5 | 0.31300 | rs767828673 | chr15 | 34597819 | SLC12A6 | protein_coding | intronic | None | None | None | None | None | None |
| 15:34305621:T:A | 9.65 × 10−5 | 0.31300 | rs77806292 | chr15 | 34597822 | SLC12A6 | protein_coding | intronic | None | None | None | None | None | None |
| 6:54396894:AT:A | 1.13 × 10−4 | 4.68550 | rs1219949521 | chr6 | 54261692 | None | None | None | TINAG | protein_coding | 6742 | CLNS1AP1 | pseudogene | 88275 |
| 15:60896319:C:G | 1.14 × 10−4 | 0.12329 | rs4775313 | chr15 | 61188518 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:34317573:G:A | 1.19 × 10−4 | 0.32204 | rs145719616 | chr15 | 34609774 | SLC12A6 | protein_coding | intronic | None | None | None | None | None | None |
| 15:60895805:T:C | 1.28 × 10−4 | 0.14405 | rs11071566 | chr15 | 61188004 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60802914:C:A | 1.82 × 10−4 | 0.96862 | rs143746632 | chr15 | 61095113 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| Variation.ID | PHRED |
|---|---|
| rs1219949521 | 0.537 |
| rs77806292 | 0.706 |
| rs145719616 | 0.225 |
| rs143746632 | 6.598 |
| rs11071566 | 3.763 |
| rs4775313 | 7.355 |
| rs4774377 | 6.006 |
| rs877863 | 1.697 |
| rs144399166 | 8.465 |
| rsid | gene_id | pval_nominal | Tissue |
|---|---|---|---|
| rs77806292 | ENSG00000140199.11 | 5.65605e-09 | Esophagus_Mucosa |
| rs145719616 | ENSG00000140199.11 | 2.10656e-08 | Esophagus_Mucosa |
| Variation.ID | Overlapped.Gene | Trait_chr | Trait_start | Trait_end | Mapped_gene | Pvalue | Tissue | Population | PMID |
|---|---|---|---|---|---|---|---|---|---|
| rs77806292 | SLC12A6 | 15 | 34502498 | 34502498 | KATNBL1 | 5.97 × 10−9 | Blood | EUR | 27036880 |
| rs145719616 | SLC12A6 | 15 | 34502498 | 34502498 | KATNBL1 | 1.22 × 10−8 | Blood | EUR | 27036880 |
| rs4775313 | RORA | 15 | 61195735 | 61195735 | NULL | 1.39 × 10−18 | Blood | EUR | 26699738 |
| rs4774377 | RORA | 15 | 61194101 | 61194101 | NULL | 2.15 × 10−8 | Blood | EUR | 26699738 |
| rs4774377 | RORA | 15 | 61195846 | 61195846 | NULL | 1.60 × 10−7 | Blood | EUR | 26699738 |
| rs877863 | RORA | 15 | 61194218 | 61194218 | NULL | 6.34 × 10−30 | Blood | EUR | 26699738 |
C2_V2
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 6:54352169:C:T | 3.53 × 10−6 | 0.317670 | rs72959316 | chr6 | 54216967 | TINAG | protein_coding | intronic | None | None | None | None | None | None |
| 15:60845514:G:A | 2.35 × 10−5 | 0.098117 | rs17303202 | chr15 | 61137713 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60652816:T:C | 9.50 × 10−5 | 0.109130 | rs17237318 | chr15 | 60945015 | RORA | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:60963161:C:T | 1.13 × 10−4 | 5.922400 | rs190295359 | chr15 | 61255360 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60580912:G:A | 1.15 × 10−4 | 0.101800 | rs340002 | chr15 | 60873111 | RP11-219B17.1 | antisense | non-coding intronic | None | None | None | None | None | None |
| 15:60580912:G:A | 1.15 × 10−4 | 0.101800 | rs340002 | chr15 | 60873111 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 8:70677171:G:GGTCTCACTTTGTTGCCCAGTCTGGAGTGCAGCGAT | 2.16 × 10−4 | 0.571820 | rs1193443704 | chr8 | 71589406 | XKR9 | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 15:60655668:A:G | 2.53 × 10−4 | 0.101010 | rs56999424 | chr15 | 60947867 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 1:167300839:C:T | 2.75 × 10−4 | 0.331330 | rs150845001 | chr1 | 167270076 | POU2F1 | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 15:60577007:A:T | 3.58 × 10−4 | -0.092052 | rs12912196 | chr15 | 60869206 | RP11-219B17.1 | antisense | non-coding intronic | None | None | None | None | None | None |
| 15:60577007:A:T | 3.58 × 10−4 | -0.092052 | rs12912196 | chr15 | 60869206 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 1:167339162:C:T | 4.05 × 10−4 | 0.315180 | rs76244803 | chr1 | 167308399 | POU2F1 | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| rsid | gene_id | pval_nominal | Tissue |
|---|---|---|---|
| rs150845001 | ENSG00000143162.7 | 4.62926e-06 | Brain_Amygdala |
| rs76244803 | ENSG00000143162.7 | 4.62926e-06 | Brain_Amygdala |
| rs150845001 | ENSG00000225171.2 | 1.25359e-05 | Esophagus_Gastroesophageal_Junction |
| rs76244803 | ENSG00000225171.2 | 1.25359e-05 | Esophagus_Gastroesophageal_Junction |
| rs12912196 | ENSG00000069667.15 | 3.89608e-05 | Pancreas |
| Variation.ID | Overlapped.Gene | Trait_chr | Trait_start | Trait_end | Mapped_gene | Pvalue | Tissue | Population | PMID |
|---|---|---|---|---|---|---|---|---|---|
| rs17303202 | RORA | 17 | 78163790 | 78163790 | CARD14 | 7.59 × 10−8 | Blood | EUR | 27036880 |
| rs12912196 | RP11-219B17.1 | 16 | 740572 | 740572 | WDR24 | 2.57 × 10−8 | Blood | EUR | 27036880 |
| rs12912196 | RP11-219B17.1 | 15 | 60690667 | 60690667 | ANXA2 | 7.84 × 10−7 | Blood | EAS | 29476079 |
| rs12912196 | RORA | 16 | 740572 | 740572 | WDR24 | 2.57 × 10−8 | Blood | EUR | 27036880 |
| rs12912196 | RORA | 15 | 60690667 | 60690667 | ANXA2 | 7.84 × 10−7 | Blood | EAS | 29476079 |
D1_V2
| SNP_hg38 | Pvalue | Beta | RSIDs | Chromosome | Position | Overlapped.Gene | Type | Annotation | Nearest.Upstream.Gene | Type.of.Nearest.Upstream.Gene | Distance.to.Nearest.Upstream.Gene | Nearest.Downstream.Gene | Type.of.Nearest.Downstream.Gene | Distance.to.Nearest.Downstream.Gene |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 3:155148344:C:T | 3.28 × 10−4 | 2.56820 | rs61758206 | chr3 | 154866133 | MME | protein_coding | intronic | None | None | None | None | None | None |
| 6:46816273:A:T | 5.36 × 10−4 | 1.05850 | rs114538502 | chr6 | 46784010 | MEP1A | protein_coding | intronic | None | None | None | None | None | None |
| 19:18444382:C:T | 5.85 × 10−4 | 5.71260 | rs535476624 | chr19 | 18555192 | ELL | protein_coding | 3downstream,3utr | None | None | None | None | None | None |
| 1:167387443:C:T | 1.02 × 10−3 | 6.68660 | rs12127704 | chr1 | 167356680 | POU2F1 | protein_coding | non-coding intronic,intronic,3downstream | None | None | None | None | None | None |
| 15:60573782:G:A | 1.14 × 10−3 | 5.41050 | rs563560240 | chr15 | 60865981 | RP11-219B17.1 | antisense | non-coding intronic | None | None | None | None | None | None |
| 15:60573782:G:A | 1.14 × 10−3 | 5.41050 | rs563560240 | chr15 | 60865981 | RORA | protein_coding | non-coding intronic,intronic | None | None | None | None | None | None |
| 21:42686952:G:C | 1.37 × 10−3 | 1.77810 | rs551395849 | chr21 | 44107062 | PDE9A | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 8:7065086:C:T | 1.61 × 10−3 | -0.50667 | rs117847654 | chr8 | 6922608 | None | None | None | DEFA5 | protein_coding | 8352 | AF238378.7 | pseudogene | 17885 |
| 2:161997917:G:A | 1.99 × 10−3 | 0.49781 | rs16846230 | chr2 | 162854427 | DPP4 | protein_coding | intronic,non-coding intronic | None | None | None | None | None | None |
| 2:162022259:C:T | 2.15 × 10−3 | 0.48864 | rs3788980 | chr2 | 162878769 | DPP4 | protein_coding | 5upstream,non-coding intronic,intronic | None | None | None | None | None | None |
| 3:155063868:A:G | 2.35 × 10−3 | 0.18116 | rs10446333 | chr3 | 154781657 | MME | protein_coding | intronic | None | None | None | None | None | None |
| Variation.ID | PHRED |
|---|---|
| rs535476624 | 16.060 |
| rs10446333 | 7.243 |
| rs114538502 | 0.003 |
| rs12127704 | 2.323 |
| rs563560240 | 4.818 |
| rs551395849 | 1.079 |
| rs61758206 | 2.784 |
| rs16846230 | 0.438 |
| rs3788980 | 1.552 |
| rs117847654 | 0.652 |
| rsid | gene_id | pval_nominal | Tissue |
|---|
| Variation.ID | Overlapped.Gene | Trait_chr | Trait_start | Trait_end | Mapped_gene | Pvalue | Tissue | Population | PMID |
|---|---|---|---|---|---|---|---|---|---|
| rs16846230 | DPP4 | 24 | 21239607 | 21239607 | TTTY14 | 1.48 × 10−11 | Blood | EUR | 27036880 |
| rs16846230 | DPP4 | 24 | 2655942 | 2655942 | SRY | 1.35 × 10−8 | Blood | EUR | 27036880 |
| rs16846230 | DPP4 | 24 | 2708972 | 2708972 | RPS4Y1 | 1.41 × 10−10 | Blood | EUR | 27036880 |
| rs3788980 | DPP4 | 24 | 21239607 | 21239607 | TTTY14 | 1.36 × 10−10 | Blood | EUR | 27036880 |
| rs3788980 | DPP4 | 24 | 27009430 | 27009430 | DAZ2 | 1.80 × 10−10 | Blood | EUR | 27036880 |
| rs3788980 | DPP4 | 24 | 2708972 | 2708972 | RPS4Y1 | 8.75 × 10−10 | Blood | EUR | 27036880 |
| rs3788980 | DPP4 | 7 | 158339017 | 158339017 | PTPRN2 | 5.20 × 10−8 | Blood | EUR | 27036880 |
| rs3788980 | DPP4 | 24 | 8553009 | 8553009 | TTTY18 | 8.44 × 10−12 | Blood | EUR | 27036880 |
| rs117847654 | None | 24 | 6742689 | 6742689 | AMELY | 3.20 × 10−8 | Blood | EUR | 27036880 |