1. The ACE2 gene connectome - List of genes from network sources

Data collection

## Cache found

2. Tissue enrichment

Tissue enrichment of all genes (analyzed in FUMA)

3. Gene-drug interactions and enrichment of functional processes from drugs

A. Gene-drug interaction from dgidb

B. Gene function enrichment (from Reactome db) of aforementioned identified drugs

Table for above graph

$Pathway based similarity of drugs$

Pathway based similarity of drugs

4. PheWAS of genes

AAMP

## [1] "Number of data points: 245"

## 
## Not.Signi     Signi 
##       203        42

ACE

## [1] "Number of data points: 323"

## 
## Not.Signi     Signi 
##       300        23

ACE2

## [1] "Number of data points: 64"

## 
## Not.Signi 
##        64

ALDOB

## [1] "Number of data points: 240"

## 
## Not.Signi     Signi 
##       239         1

AGT

## [1] "Number of data points: 393"

## 
## Not.Signi     Signi 
##       380        13

APOA1

## [1] "Number of data points: 401"

## 
## Not.Signi     Signi 
##       296       105

APOBEC1

## [1] "Number of data points: 267"

## 
## Not.Signi     Signi 
##       265         2

CALM1

## [1] "Number of data points: 259"

## 
## Not.Signi 
##       259

CALM2

## [1] "Number of data points: 247"

## 
## Not.Signi     Signi 
##       237        10

CAT

## [1] "Number of data points: 228"

## 
## Not.Signi     Signi 
##       226         2

CLCA1

## [1] "Number of data points: 324"

## 
## Not.Signi     Signi 
##       322         2

DEFA5

## [1] "Number of data points: 223"

## 
## Not.Signi     Signi 
##       212        11

DEFA6

## [1] "Number of data points: 218"

## 
## Not.Signi 
##       218

DPEP1

## [1] "Number of data points: 466"

## 
## Not.Signi     Signi 
##       400        66

DPP4

## [1] "Number of data points: 477"

## 
## Not.Signi     Signi 
##       431        46

FABP1

## [1] "Number of data points: 260"

## 
## Not.Signi     Signi 
##       258         2

FABP2

## [1] "Number of data points: 422"

## 
## Not.Signi     Signi 
##       382        40

GHRL

## [1] "Number of data points: 314"

## 
## Not.Signi     Signi 
##       311         3

HRAS

## [1] "Number of data points: 226"

## 
## Not.Signi     Signi 
##       224         2

ISYNA1

## [1] "Number of data points: 425"

## 
## Not.Signi     Signi 
##       393        32

IYD

## [1] "Number of data points: 256"

## 
## Not.Signi 
##       256

KDM3A

## [1] "Number of data points: 342"

## 
## Not.Signi     Signi 
##       292        50

LACTB2

## [1] "Number of data points: 376"

## 
## Not.Signi     Signi 
##       357        19

LRRC19

## [1] "Number of data points: 269"

## 
## Not.Signi     Signi 
##       266         3

MEP1A

## [1] "Number of data points: 243"

## 
## Not.Signi 
##       243

MEP1B

## [1] "Number of data points: 237"

## 
## Not.Signi     Signi 
##       236         1

MME

## [1] "Number of data points: 296"

## 
## Not.Signi     Signi 
##       294         2

NTS

## [1] "Number of data points: 196"

## 
## Not.Signi     Signi 
##       195         1

PDE9A

## [1] "Number of data points: 366"

## 
## Not.Signi     Signi 
##       360         6

PLA2G12B

## [1] "Number of data points: 307"

## 
## Not.Signi     Signi 
##       302         5

POU2F1

## [1] "Number of data points: 314"

## 
## Not.Signi     Signi 
##       307         7

PRCP

## [1] "Number of data points: 313"

## 
## Not.Signi     Signi 
##       308         5

RASEF

## [1] "Number of data points: 257"

## 
## Not.Signi     Signi 
##       254         3

SI

## [1] "Number of data points: 217"

## 
## Not.Signi     Signi 
##       216         1

SLC10A2

## [1] "Number of data points: 275"

## 
## Not.Signi     Signi 
##       273         2

SLC12A6

## [1] "Number of data points: 309"

## 
## Not.Signi     Signi 
##       308         1

SLC37A1

## [1] "Number of data points: 347"

## 
## Not.Signi     Signi 
##       346         1

SLC3A1

## [1] "Number of data points: 384"

## 
## Not.Signi     Signi 
##       360        24

SLC44A4

## [1] "Number of data points: 957"

## 
## Not.Signi     Signi 
##       682       275

SLC6A19

## [1] "Number of data points: 167"

## 
## Not.Signi 
##       167

TINAG

## [1] "Number of data points: 335"

## 
## Not.Signi     Signi 
##       330         5

TMEM27

## [1] "Number of data points: 80"

## 
## Not.Signi     Signi 
##        79         1

TMPRSS2

## [1] "Number of data points: 227"

## 
## Not.Signi 
##       227

TRPM4

## [1] "Number of data points: 252"

## 
## Not.Signi     Signi 
##       249         3

XPNPEP2

## [1] "Number of data points: 83"

## 
## Not.Signi 
##        83

RORC

## [1] "Number of data points: 527"

## 
## Not.Signi     Signi 
##       503        24

RORA

## [1] "Number of data points: 632"

## 
## Not.Signi     Signi 
##       529       103

RORB

## [1] "Number of data points: 428"

## 
## Not.Signi     Signi 
##       404        24

NR5A2

## [1] "Number of data points: 444"

## 
## Not.Signi     Signi 
##       425        19

NR5A1

## [1] "Number of data points: 255"

## 
## Not.Signi     Signi 
##       241        14

LRRC15

## [1] "Number of data points: 181"

## 
## Not.Signi     Signi 
##       180         1

Gene Prioritization

Distribution of genes for significant traits grouped by domains

Enrichment test for domains

The distribution of genes in immunological domain

The distribution of genes in respiratory domain

The distribution of genes in environmental domain

The distribution of genes in skeletal domain

The distribution of genes in Dermatological domain

The distribution of genes in Connective Tissue domain

Common Genes

## Warning: package 'venn' was built under R version 3.6.3

5. Characterization of SNPs

SNPs that are within +/- 10kb of the gene positions and population frequency (db153; hg19)

##   Variation.ID        dbSNP Chromosome  Position REF.Allele ALT.Allele..IUPAC.
## 1  rs760194105  rs760194105          1 151768549       ATTC                  -
## 2 rs1265893702 rs1265893702          1 151768556          C                  T
## 3 rs1195052699 rs1195052699          1 151768558          A                  G
## 4 rs1488141823 rs1488141823          1 151768564          G                  Y
## 5 rs1202366215 rs1202366215          1 151768566          T                  G
## 6  rs545985998  rs545985998          1 151768567          C                  G
##   Minor.Allele Minor.Allele.Global.Frequency     Contig Contig.Position  Band
## 1         None                          None GL000016.1         3257191 q21.3
## 2         None                          None GL000016.1         3257198 q21.3
## 3         None                          None GL000016.1         3257200 q21.3
## 4         None                          None GL000016.1         3257206 q21.3
## 5         None                          None GL000016.1         3257208 q21.3
## 6            G                      0.000200 GL000016.1         3257209 q21.3

Download full length results here:

Nearest gene annotation

##   Variation.ID Chromosome  Position Overlapped.Gene Type Annotation
## 1         <NA>       <NA>        NA            <NA> <NA>       <NA>
## 2  rs760194105       chr1 151768549            None None       None
## 3 rs1265893702       chr1 151768556            None None       None
## 4 rs1195052699       chr1 151768558            None None       None
## 5 rs1488141823       chr1 151768564            None None       None
## 6 rs1202366215       chr1 151768566            None None       None
##   Nearest.Upstream.Gene Type.of.Nearest.Upstream.Gene
## 1                  <NA>                          <NA>
## 2          RP11-98D18.9                     antisense
## 3          RP11-98D18.9                     antisense
## 4          RP11-98D18.9                     antisense
## 5          RP11-98D18.9                     antisense
## 6          RP11-98D18.9                     antisense
##   Distance.to.Nearest.Upstream.Gene Nearest.Downstream.Gene
## 1                              <NA>                    <NA>
## 2                              1671           RP11-98D18.17
## 3                              1678           RP11-98D18.17
## 4                              1680           RP11-98D18.17
## 5                              1686           RP11-98D18.17
## 6                              1688           RP11-98D18.17
##   Type.of.Nearest.Downstream.Gene Distance.to.Nearest.Downstream.Gene
## 1                            <NA>                                <NA>
## 2                         lincRNA                                1981
## 3                         lincRNA                                1974
## 4                         lincRNA                                1972
## 5                         lincRNA                                1966
## 6                         lincRNA                                1964

Download full length results here:

CADD Scores

##   Variation.ID Chromosome  Position Variant PHRED
## 1 rs1265893702       chr1 151768556     C/T 13.53
## 2 rs1195052699       chr1 151768558     A/G 12.55
## 3 rs1309532353       chr1 151768828     T/C 15.02
## 4  rs946376285       chr1 151768833     G/A 14.38
## 5 rs1044802297       chr1 151768837     C/T 15.29
## 6  rs903034465       chr1 151768839     G/C 16.03

Download annotation for CADD PHRED score > 10 here:

DeepSEA

##   Variation.ID Chromosome Position Variant Functional.Significance.Score
## 1  rs543482228      chr11   522483     C/T                       0.55310
## 2  rs763218255      chr11   522724     A/T                       0.52076
## 3 rs1381432050      chr11   522725     A/T                       0.53188
## 4 rs1048970710      chr11   522953     T/A                       0.50105
## 5 rs1030030831      chr11   523050     A/G                       0.53433
## 6  rs987669684      chr11   525258     G/A                       0.62874
##   eQTL.Probability GWAS.Probability HGMD.Probability
## 1          0.35134          0.27441          0.36835
## 2          0.37491          0.29143          0.36774
## 3          0.42790          0.30231          0.37801
## 4          0.34974          0.27633          0.37562
## 5          0.41663          0.31488          0.37194
## 6          0.35291          0.24213          0.36358

Download annotation for score > 0.5 :

Enrichment of cluster, disease, function using miRNA targets from SNPs

Cluster

Family

Function

Disease (152 significant observations; top 50 shown in figure)

Top 50 FDR-significant associations are shown in the bar graph and all significant associations are shown in the table listed under the figure

## Selecting by Term.2

6. Neanderthal LA in our COVID-19 ACE2 network SNP set

We compared mean probability of Neanderthal LA between the ACE2 network SNP set (mean=0.032) and 1,000 randomly selected SNP sets with comparable genomic features (range of Neanderthal LA means = 0.027-0.036). The ACE2 network SNP set had significantly greater Neanderthal LA probabilities than 663/1,000 randomly selected SNP sets.

Neanderthal LA in SNPs COVID-19 ACE2 network against randomly selected SNPs

7. SNPs from the COVID19-HGI initiative (Freeze 3) for all six phenotypes

P-value of network-SNPs from from the COVID19-HGI initiative (Freeze 3) for all six phenotypes - https://www.covid19hg.org/results/

A2_V2 (very severe respiratory confirmed covid vs. population; Population -Total Cases= 536 | Total Controls= 329391)

A2_V2

Top 10 lowest P-value of SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
15:60803856:C:T	1.88 × 10⁻⁴	0.36074	rs875339	chr15	61096055	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:60810211:C:T	8.13 × 10⁻⁴	0.31381	rs341419	chr15	61102410	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60822458:C:T	1.45 × 10⁻³	0.30401	rs10152719	chr15	61114657	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
8:70666606:C:T	1.73 × 10⁻³	-0.68765	rs113026226	chr8	71578841	LACTB2	protein_coding	intronic	None	None	None	None	None	None
15:60817912:G:A	1.74 × 10⁻³	0.30088	rs12903157	chr15	61110111	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:34253720:A:G	1.86 × 10⁻³	0.28489	rs2705343	chr15	34545921	SLC12A6	protein_coding	intronic	None	None	None	None	None	None
15:60820454:C:A	1.92 × 10⁻³	0.29993	rs12899389	chr15	61112653	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60825666:C:T	2.07 × 10⁻³	0.28660	rs16943172	chr15	61117865	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60820966:C:T	2.15 × 10⁻³	0.29404	rs1406667914	chr15	61113160	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60820966:C:T	2.15 × 10⁻³	0.29404	rs78461015	chr15	61113165	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None

CADD Scores

GTEX-eQTLs

rsid	gene_id	pval_nominal	Tissue
rs2705343	ENSG00000128463.12	9.13389e-09	Adipose_Subcutaneous
rs2705343	ENSG00000182117.5	9.44896e-07	Adipose_Subcutaneous
rs2705343	ENSG00000128463.12	1.81195e-05	Adipose_Visceral_Omentum
rs2705343	ENSG00000182117.5	8.06961e-06	Adipose_Visceral_Omentum
rs2705343	ENSG00000128463.12	2.59033e-05	Artery_Aorta
rs2705343	ENSG00000140199.11	1.40008e-11	Artery_Aorta
rs113026226	ENSG00000221947.7	5.89704e-05	Artery_Tibial
rs2705343	ENSG00000134152.10	9.04087e-06	Artery_Tibial
rs2705343	ENSG00000128463.12	9.43125e-09	Artery_Tibial
rs2705343	ENSG00000128463.12	4.65998e-07	Cells_Cultured_fibroblasts
rs2705343	ENSG00000140199.11	2.54972e-08	Cells_Cultured_fibroblasts
rs2705343	ENSG00000128463.12	5.32373e-07	Colon_Sigmoid
rs2705343	ENSG00000128463.12	5.18709e-08	Esophagus_Gastroesophageal_Junction
rs2705343	ENSG00000128463.12	5.11224e-20	Esophagus_Mucosa
rs2705343	ENSG00000140199.11	1.47766e-18	Esophagus_Mucosa
rs113026226	ENSG00000221947.7	1.38624e-04	Esophagus_Muscularis
rs2705343	ENSG00000128463.12	2.10740e-08	Esophagus_Muscularis
rs2705343	ENSG00000182117.5	4.99233e-05	Esophagus_Muscularis
rs2705343	ENSG00000182117.5	2.01836e-07	Heart_Left_Ventricle
rs2705343	ENSG00000182117.5	1.82788e-12	Lung
rs113026226	ENSG00000221947.7	1.75744e-06	Muscle_Skeletal
rs2705343	ENSG00000128463.12	4.72857e-06	Muscle_Skeletal
rs2705343	ENSG00000140199.11	2.76234e-06	Muscle_Skeletal
rs2705343	ENSG00000182117.5	5.54404e-25	Muscle_Skeletal
rs2705343	ENSG00000128463.12	1.93078e-08	Nerve_Tibial
rs2705343	ENSG00000140199.11	6.22189e-05	Nerve_Tibial
rs2705343	ENSG00000128463.12	1.41336e-11	Skin_Not_Sun_Exposed_Suprapubic
rs2705343	ENSG00000140199.11	2.54975e-07	Skin_Not_Sun_Exposed_Suprapubic
rs113026226	ENSG00000221947.7	1.29050e-05	Skin_Sun_Exposed_Lower_leg
rs2705343	ENSG00000128463.12	4.43092e-10	Skin_Sun_Exposed_Lower_leg
rs2705343	ENSG00000140199.11	6.09070e-05	Skin_Sun_Exposed_Lower_leg
rs2705343	ENSG00000128463.12	2.22679e-06	Spleen
rs2705343	ENSG00000182117.5	1.60123e-09	Spleen
rs2705343	ENSG00000140199.11	1.58268e-11	Testis
rs2705343	ENSG00000128463.12	1.56088e-07	Thyroid
rs2705343	ENSG00000140199.11	7.01860e-16	Thyroid
rs2705343	ENSG00000134152.10	3.01523e-05	Whole_Blood
rs2705343	ENSG00000182117.5	6.16437e-28	Whole_Blood

mQTLs (cis and trans)

B1_V2 Phenotype (hospitalized covid vs. not hospitalized covid; Population Total Cases - 928 | Total Controls - 2028)

B1_V2

Top 10 lowest SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
1:200092745:A:G	2.81 × 10⁻⁵	-0.73277	rs3790826	chr1	200061873	NR5A2	protein_coding	intronic	None	None	None	None	None	None
3:10277484:C:T	4.67 × 10⁻⁵	-0.83174	rs115313152	chr3	10319168	TATDN2	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
3:10277484:C:T	4.67 × 10⁻⁵	-0.83174	rs115313152	chr3	10319168	RP11-438J1.1	protein_coding	intronic	None	None	None	None	None	None
1:86481385:C:T	1.09 × 10⁻⁴	0.77155	rs5744352	chr1	86947068	CLCA1	protein_coding	intronic	None	None	None	None	None	None
3:194378110:G:A	1.74 × 10⁻⁴	-0.62045	rs143975519	chr3	194098839	None	None	None	LRRC15	protein_coding	8367	GP5	protein_coding	16711
5:1211624:A:G	2.52 × 10⁻⁴	0.51892	rs76067074	chr5	1211739	SLC6A19	protein_coding	intronic	None	None	None	None	None	None
18:32200733:G:A	2.56 × 10⁻⁴	-2.12170	rs146307802	chr18	29780696	GAREM	protein_coding	intronic	None	None	None	None	None	None
18:32200733:G:A	2.56 × 10⁻⁴	-2.12170	rs146307802	chr18	29780696	MEP1B	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
5:1215359:G:A	3.15 × 10⁻⁴	0.33416	rs11133684	chr5	1215474	SLC6A19	protein_coding	intronic	None	None	None	None	None	None
13:103068707:C:G	3.62 × 10⁻⁴	-1.99870	rs61966076	chr13	103721057	None	None	None	SLC10A2	protein_coding	1861	RP11-123H22.1	lincRNA	356493
13:103049298:A:G	3.89 × 10⁻⁴	-1.96380	rs61966074	chr13	103701648	SLC10A2	protein_coding	coding nonsyn	None	None	None	None	None	None
14:90416597:A:G	4.16 × 10⁻⁴	-1.39440	rs78610223	chr14	90882941	None	None	None	CALM1	protein_coding	8336	RP11-1078H9.1	lincRNA	35466

CADD Scores

GTEX-eQTLs

rsid	gene_id	pval_nominal	Tissue
rs115313152	ENSG00000231177.4	6.62376e-06	Cells_Cultured_fibroblasts
rs78610223	ENSG00000100784.10	6.86986e-06	Cells_Cultured_fibroblasts

mQTLs (cis and trans)

B2_V2 Phenotype (hospitalized covid vs. population; Population Total Cases - 3199 | Total Controls - 897488)

B2_V2 hospitalized covid (n=3199) vs. population (n=897488)

Top 10 lowest SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
15:60845514:G:A	2.75 × 10⁻⁵	0.15168	rs17303202	chr15	61137713	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
10:72931692:A:G	8.27 × 10⁻⁵	0.41731	rs117501894	chr10	74691450	OIT3	protein_coding	intronic	None	None	None	None	None	None
15:60879331:T:C	4.40 × 10⁻⁴	0.11702	rs1482060	chr15	61171530	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:61197617:G:A	4.80 × 10⁻⁴	0.59610	rs117605488	chr15	61489816	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60867245:C:T	5.69 × 10⁻⁴	0.12355	rs72750668	chr15	61159444	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
2:86466350:C:A	5.78 × 10⁻⁴	2.14360	rs200859016	chr2	86693473	KDM3A	protein_coding	intronic,5upstream,non-coding intronic	None	None	None	None	None	None
15:61081664:C:T	6.70 × 10⁻⁴	1.19640	rs555160850	chr15	61373863	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:60522867:C:T	6.95 × 10⁻⁴	2.13780	rs576742037	chr15	60815066	RP11-219B17.1	antisense	non-coding intronic	None	None	None	None	None	None
15:60522867:C:T	6.95 × 10⁻⁴	2.13780	rs576742037	chr15	60815066	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60880369:G:A	8.20 × 10⁻⁴	0.11153	rs7182717	chr15	61172568	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
1:200185981:T:C	8.41 × 10⁻⁴	1.25170	rs192505301	chr1	200155109	None	None	None	NR5A2	protein_coding	8557	FAM58BP	pseudogene	27547

CADD Scores

GTEX-eQTLs (cis)

rsid	gene_id	pval_nominal	Tissue
rs117501894	ENSG00000166295.8	1.18660e-05	Artery_Aorta
rs117501894	ENSG00000166295.8	8.96870e-07	Artery_Tibial
rs117501894	ENSG00000166295.8	1.13816e-07	Brain_Caudate_basal_ganglia
rs117501894	ENSG00000148719.14	5.47445e-05	Brain_Cerebellar_Hemisphere
rs117501894	ENSG00000166295.8	4.36824e-06	Brain_Cortex
rs117501894	ENSG00000166295.8	6.34330e-08	Esophagus_Muscularis
rs117501894	ENSG00000166295.8	1.70936e-06	Lung
rs117501894	ENSG00000148719.14	1.46215e-04	Muscle_Skeletal
rs117501894	ENSG00000166295.8	8.06329e-05	Nerve_Tibial
rs117501894	ENSG00000222047.8	1.67934e-04	Skin_Sun_Exposed_Lower_leg
rs117501894	ENSG00000166295.8	3.99610e-07	Thyroid

mQTLs (cis and trans)

Variation.ID	Overlapped.Gene	Trait_chr	Trait_start	Trait_end	Mapped_gene	Pvalue	Tissue	Population	PMID
rs17303202	RORA	17	78163790	78163790	CARD14	7.59 × 10⁻⁸	Blood	EUR	27036880

C1_V2 Phenotype (covid vs. lab/self-reported negative; Population Total Cases - 3523 | Total Controls - 36634)

C1_V2

Top 10 lowest SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
1:200180979:C:T	5.19 × 10⁻⁵	3.09390	rs144399166	chr1	200150107	None	None	None	NR5A2	protein_coding	3555	FAM58BP	pseudogene	32549
15:60902209:A:G	8.25 × 10⁻⁵	0.12511	rs4774377	chr15	61194408	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60902607:T:C	8.83 × 10⁻⁵	0.12455	rs877863	chr15	61194806	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:34305621:T:A	9.65 × 10⁻⁵	0.31300	rs767828673	chr15	34597819	SLC12A6	protein_coding	intronic	None	None	None	None	None	None
15:34305621:T:A	9.65 × 10⁻⁵	0.31300	rs77806292	chr15	34597822	SLC12A6	protein_coding	intronic	None	None	None	None	None	None
6:54396894:AT:A	1.13 × 10⁻⁴	4.68550	rs1219949521	chr6	54261692	None	None	None	TINAG	protein_coding	6742	CLNS1AP1	pseudogene	88275
15:60896319:C:G	1.14 × 10⁻⁴	0.12329	rs4775313	chr15	61188518	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:34317573:G:A	1.19 × 10⁻⁴	0.32204	rs145719616	chr15	34609774	SLC12A6	protein_coding	intronic	None	None	None	None	None	None
15:60895805:T:C	1.28 × 10⁻⁴	0.14405	rs11071566	chr15	61188004	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60802914:C:A	1.82 × 10⁻⁴	0.96862	rs143746632	chr15	61095113	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None

CADD Scores

Variation.ID	PHRED
rs1219949521	0.537
rs77806292	0.706
rs145719616	0.225
rs143746632	6.598
rs11071566	3.763
rs4775313	7.355
rs4774377	6.006
rs877863	1.697
rs144399166	8.465

GTEX-eQTLs

rsid	gene_id	pval_nominal	Tissue
rs77806292	ENSG00000140199.11	5.65605e-09	Esophagus_Mucosa
rs145719616	ENSG00000140199.11	2.10656e-08	Esophagus_Mucosa

mQTLs (cis and trans)

Variation.ID	Overlapped.Gene	Trait_chr	Trait_start	Trait_end	Mapped_gene	Pvalue	Tissue	Population	PMID
rs77806292	SLC12A6	15	34502498	34502498	KATNBL1	5.97 × 10⁻⁹	Blood	EUR	27036880
rs145719616	SLC12A6	15	34502498	34502498	KATNBL1	1.22 × 10⁻⁸	Blood	EUR	27036880
rs4775313	RORA	15	61195735	61195735	NULL	1.39 × 10⁻¹⁸	Blood	EUR	26699738
rs4774377	RORA	15	61194101	61194101	NULL	2.15 × 10⁻⁸	Blood	EUR	26699738
rs4774377	RORA	15	61195846	61195846	NULL	1.60 × 10⁻⁷	Blood	EUR	26699738
rs877863	RORA	15	61194218	61194218	NULL	6.34 × 10⁻³⁰	Blood	EUR	26699738

C2_V2 Phenotype (covid vs. population; Population Total Cases - 6696 | Total Controls - 1073072)

C2_V2

Top 10 lowest SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
6:54352169:C:T	3.53 × 10⁻⁶	0.317670	rs72959316	chr6	54216967	TINAG	protein_coding	intronic	None	None	None	None	None	None
15:60845514:G:A	2.35 × 10⁻⁵	0.098117	rs17303202	chr15	61137713	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60652816:T:C	9.50 × 10⁻⁵	0.109130	rs17237318	chr15	60945015	RORA	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:60963161:C:T	1.13 × 10⁻⁴	5.922400	rs190295359	chr15	61255360	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60580912:G:A	1.15 × 10⁻⁴	0.101800	rs340002	chr15	60873111	RP11-219B17.1	antisense	non-coding intronic	None	None	None	None	None	None
15:60580912:G:A	1.15 × 10⁻⁴	0.101800	rs340002	chr15	60873111	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
8:70677171:G:GGTCTCACTTTGTTGCCCAGTCTGGAGTGCAGCGAT	2.16 × 10⁻⁴	0.571820	rs1193443704	chr8	71589406	XKR9	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
15:60655668:A:G	2.53 × 10⁻⁴	0.101010	rs56999424	chr15	60947867	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
1:167300839:C:T	2.75 × 10⁻⁴	0.331330	rs150845001	chr1	167270076	POU2F1	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
15:60577007:A:T	3.58 × 10⁻⁴	-0.092052	rs12912196	chr15	60869206	RP11-219B17.1	antisense	non-coding intronic	None	None	None	None	None	None
15:60577007:A:T	3.58 × 10⁻⁴	-0.092052	rs12912196	chr15	60869206	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
1:167339162:C:T	4.05 × 10⁻⁴	0.315180	rs76244803	chr1	167308399	POU2F1	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None

GTEX-eQTLs

rsid	gene_id	pval_nominal	Tissue
rs150845001	ENSG00000143162.7	4.62926e-06	Brain_Amygdala
rs76244803	ENSG00000143162.7	4.62926e-06	Brain_Amygdala
rs150845001	ENSG00000225171.2	1.25359e-05	Esophagus_Gastroesophageal_Junction
rs76244803	ENSG00000225171.2	1.25359e-05	Esophagus_Gastroesophageal_Junction
rs12912196	ENSG00000069667.15	3.89608e-05	Pancreas

mQTLs (cis and trans)

Variation.ID	Overlapped.Gene	Trait_chr	Trait_start	Trait_end	Mapped_gene	Pvalue	Tissue	Population	PMID
rs17303202	RORA	17	78163790	78163790	CARD14	7.59 × 10⁻⁸	Blood	EUR	27036880
rs12912196	RP11-219B17.1	16	740572	740572	WDR24	2.57 × 10⁻⁸	Blood	EUR	27036880
rs12912196	RP11-219B17.1	15	60690667	60690667	ANXA2	7.84 × 10⁻⁷	Blood	EAS	29476079
rs12912196	RORA	16	740572	740572	WDR24	2.57 × 10⁻⁸	Blood	EUR	27036880
rs12912196	RORA	15	60690667	60690667	ANXA2	7.84 × 10⁻⁷	Blood	EAS	29476079

D1_V2 Phenotype (predicted covid from self-reported symptoms vs. predicted or self-reported non-covid; Population Total Cases - 1865 | Total Controls - 29174)

D1_V2

Top 10 lowest SNPs from the network

SNP_hg38	Pvalue	Beta	RSIDs	Chromosome	Position	Overlapped.Gene	Type	Annotation	Nearest.Upstream.Gene	Type.of.Nearest.Upstream.Gene	Distance.to.Nearest.Upstream.Gene	Nearest.Downstream.Gene	Type.of.Nearest.Downstream.Gene	Distance.to.Nearest.Downstream.Gene
3:155148344:C:T	3.28 × 10⁻⁴	2.56820	rs61758206	chr3	154866133	MME	protein_coding	intronic	None	None	None	None	None	None
6:46816273:A:T	5.36 × 10⁻⁴	1.05850	rs114538502	chr6	46784010	MEP1A	protein_coding	intronic	None	None	None	None	None	None
19:18444382:C:T	5.85 × 10⁻⁴	5.71260	rs535476624	chr19	18555192	ELL	protein_coding	3downstream,3utr	None	None	None	None	None	None
1:167387443:C:T	1.02 × 10⁻³	6.68660	rs12127704	chr1	167356680	POU2F1	protein_coding	non-coding intronic,intronic,3downstream	None	None	None	None	None	None
15:60573782:G:A	1.14 × 10⁻³	5.41050	rs563560240	chr15	60865981	RP11-219B17.1	antisense	non-coding intronic	None	None	None	None	None	None
15:60573782:G:A	1.14 × 10⁻³	5.41050	rs563560240	chr15	60865981	RORA	protein_coding	non-coding intronic,intronic	None	None	None	None	None	None
21:42686952:G:C	1.37 × 10⁻³	1.77810	rs551395849	chr21	44107062	PDE9A	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
8:7065086:C:T	1.61 × 10⁻³	-0.50667	rs117847654	chr8	6922608	None	None	None	DEFA5	protein_coding	8352	AF238378.7	pseudogene	17885
2:161997917:G:A	1.99 × 10⁻³	0.49781	rs16846230	chr2	162854427	DPP4	protein_coding	intronic,non-coding intronic	None	None	None	None	None	None
2:162022259:C:T	2.15 × 10⁻³	0.48864	rs3788980	chr2	162878769	DPP4	protein_coding	5upstream,non-coding intronic,intronic	None	None	None	None	None	None
3:155063868:A:G	2.35 × 10⁻³	0.18116	rs10446333	chr3	154781657	MME	protein_coding	intronic	None	None	None	None	None	None

CADD Scores

Variation.ID	PHRED
rs535476624	16.060
rs10446333	7.243
rs114538502	0.003
rs12127704	2.323
rs563560240	4.818
rs551395849	1.079
rs61758206	2.784
rs16846230	0.438
rs3788980	1.552
rs117847654	0.652

GTEX-eQTLs

rsid	gene_id	pval_nominal	Tissue

mQTLs (cis and trans)

Variation.ID	Overlapped.Gene	Trait_chr	Trait_start	Trait_end	Mapped_gene	Pvalue	Tissue	Population	PMID
rs16846230	DPP4	24	21239607	21239607	TTTY14	1.48 × 10⁻¹¹	Blood	EUR	27036880
rs16846230	DPP4	24	2655942	2655942	SRY	1.35 × 10⁻⁸	Blood	EUR	27036880
rs16846230	DPP4	24	2708972	2708972	RPS4Y1	1.41 × 10⁻¹⁰	Blood	EUR	27036880
rs3788980	DPP4	24	21239607	21239607	TTTY14	1.36 × 10⁻¹⁰	Blood	EUR	27036880
rs3788980	DPP4	24	27009430	27009430	DAZ2	1.80 × 10⁻¹⁰	Blood	EUR	27036880
rs3788980	DPP4	24	2708972	2708972	RPS4Y1	8.75 × 10⁻¹⁰	Blood	EUR	27036880
rs3788980	DPP4	7	158339017	158339017	PTPRN2	5.20 × 10⁻⁸	Blood	EUR	27036880
rs3788980	DPP4	24	8553009	8553009	TTTY18	8.44 × 10⁻¹²	Blood	EUR	27036880
rs117847654	None	24	6742689	6742689	AMELY	3.20 × 10⁻⁸	Blood	EUR	27036880

ACE2 Netlas

Pathak et.al

08/15/2020

1. The ACE2 gene connectome - List of genes from network sources

Data collection

2. Tissue enrichment

3. Gene-drug interactions and enrichment of functional processes from drugs

A. Gene-drug interaction from dgidb

B. Gene function enrichment (from Reactome db) of aforementioned identified drugs

4. PheWAS of genes

AAMP

ACE

ACE2

ALDOB

AGT

APOA1

APOBEC1

CALM1

CALM2

CAT

CLCA1

DEFA5

DEFA6

DPEP1

DPP4

FABP1

FABP2

GHRL

HRAS

ISYNA1

IYD

KDM3A

LACTB2

LRRC19

MEP1A

MEP1B

MME

NTS

PDE9A

PLA2G12B

POU2F1

PRCP

RASEF

SI

SLC10A2

SLC12A6

SLC37A1

SLC3A1

SLC44A4

SLC6A19

TINAG

TMEM27

TMPRSS2

TRPM4

XPNPEP2

RORC

RORA

RORB

NR5A2

NR5A1

LRRC15

Gene Prioritization

Distribution of genes for significant traits grouped by domains

Enrichment test for domains

The distribution of genes in immunological domain

The distribution of genes in respiratory domain

The distribution of genes in environmental domain

The distribution of genes in skeletal domain

The distribution of genes in Dermatological domain

The distribution of genes in Connective Tissue domain

Common Genes

5. Characterization of SNPs

SNPs that are within +/- 10kb of the gene positions and population frequency (db153; hg19)

Nearest gene annotation

CADD Scores

DeepSEA

Enrichment of cluster, disease, function using miRNA targets from SNPs

Cluster

Family

Function